The influences of cholecystectomy

SAVE OFFLINE

Chronobiology International The Journal of Biological and Medical Rhythm Research

ISSN: 0742-0528 (Print) 1525-6073 (Online) Journal homepage: http://www.tandfonline.com/loi/icbi20

The influences of cholecystectomy on the circadian rhythms of bile acids as well as the enterohepatic transporters and enzymes systems in mice Fan Zhang, Yingting Duan, Lili Xi, Mengmeng Wei, Axi Shi, Yan Zhou, Yuhui Wei & Xinan Wu To cite this article: Fan Zhang, Yingting Duan, Lili Xi, Mengmeng Wei, Axi Shi, Yan Zhou, Yuhui Wei & Xinan Wu (2018): The influences of cholecystectomy on the circadian rhythms of bile acids as well as the enterohepatic transporters and enzymes systems in mice, Chronobiology International, DOI: 10.1080/07420528.2018.1426596 To link to this article: https://doi.org/10.1080/07420528.2018.1426596

Published online: 30 Jan 2018.

Submit your article to this journal

Article views: 65

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=icbi20

CHRONOBIOLOGY INTERNATIONAL https://doi.org/10.1080/07420528.2018.1426596

The influences of cholecystectomy on the circadian rhythms of bile acids as well as the enterohepatic transporters and enzymes systems in mice Fan Zhanga,b, Yingting Duana,b, Lili Xia, Mengmeng Weia,b, Axi Shia, Yan Zhoua, Yuhui Weia, and Xinan Wua a

Department of Pharmacy, The First Hospital of Lanzhou University, Lanzhou, China; bSchool of pharmacy, Lanzhou University, Lanzhou, China ABSTRACT

KEYWORDS

Bile acids (BAs), the most important endogenous and signaling molecules regulate the target transporters and enzymes at transcriptional level, participate in a wide variety of processes throughout the entire gastrointestinal tract to orchestrate homeostasis in vivo. BAs and their metabolism and transportation appear to follow the clear circadian rhythms, and they are recently proposed also as the potential chronobiological signals that can affect the molecular clock mechanism. Cholecystectomy are believed to affect the circadian rhythms of BAs and the relevant enterohepatic transporters and enzymes systems and their regulatory signaling pathways, for the reason that the circadian cycle of gallbladder filling and emptying play a pivotal role in controlling the flow of bile into the intestine and the enterohepatic circulation of BAs. Here, in the present study, the circadian rhythms about BAs concentration and composition and the mRNA expression of genes involved in BAs transportation, metabolism and regulation in liver and ileum of mice with or without gallbladder were evaluated. As a result, it has been found that, mice with gallbladder exhibited significant and distinct circadian oscillations in BAs concentration, mRNA expression of enterohepatic transporters and enzymes systems and farnesoid X receptormediated regulatory pathways both in liver and ileum during gallbladder emptying period (1:00 AM and 1:00 PM), despite food was restricted during these periods; the circadian rhythmicity of BAs pool and hepatic and ileal BAs diminished but the BAs composition had no significant alteration in liver and ileum after cholecystectomy as compared with sham-operated mice; in parallel to the alteration of BAs levels in liver and ileum after cholecystectomy, the day/night circadian oscillations in the mRNA expression of the relevant transporting and metabolic genes and the farnesoid X receptor signaling pathway-mediated “intestine-liver†regulatory axis also shifted. In conclusion, the BAs concentration and the corresponding genes exhibit significant circadian rhythms in mice with gallbladder, and the circadian oscillations of most of the investigation factors are flattened and altered following by cholecystectomy, which could mainly ascribe to the disappearance of the filling and emptying cycle of gallbladder and might result in pathological states or drug chronopharmacology alternation. We expect that this study would provide a cue for patients with cholecystectomy.

Circadian rhythms; Cholecystectomy; Bile acids; Enzyme; Transporter

Abbreviations: Asbt: apical sodium-dependent bile acids transporter; AUC24h: area under the 24hour BA concentration time curve; BAs: bile acids; Bsep: bile salt export pump; β-MCA: β-muricholic acid; CA: cholic acid; CDCA: chenodeoxycholic acid; Cyp3a11: cytochrome P450 3a11 (human CYP3A4); Cyp7a1: cholesterol 7α-hydroxylase cytochrome P450 7a1; DCA: deoxycholic acid; Fxr: farnesoid X receptor; Fgf15: fibroblast growth factor 15; G-: glycine conjugated bile acid; HDCA: hyodesoxycholic acid; LCA: lithocholic acid; Mrp2: multidrug resistance-associated protein 2; NDCA: demethylation deoxycholic acid; Ntcp: Na+-taurocholate co-transporting polypeptide; Oatp2: organic anion transporting polypeptide 2; Ostα/β: heterodimeric organic solute transporters alpha and beta; Shp: small heterodimer partner; T-: taurine conjugated bile acid; UDCA: ursodeoxycholic acid.

Introduction The circadian rhythms physiological processes (circadian clock) of endogenous substances play a pivotal role in synchronizing the physiology and behavior to day–night cycles for adaption to daily

environmental changes (Reinke and Asher 2016). Bile acids (BAs), one of the most important endogenous participating in a wide variety of processes throughout the entire gastrointestinal tract, appear to be under the time-of-day

CONTACT Xinan Wu [email protected] Department of Pharmacy, The First Hospital of Lanzhou University, NO. 1 of DongGang West Road, Lanzhou, Gansu Province, China Color versions of one or more of the figures in the article can be found online at www.tandfonline.com/icbi. © 2018 Taylor & Francis Group, LLC

2

F. ZHANG ET AL.

circadian control (Zhang et al. 2011). Even more importantly, BAs have also been proposed as potential chronobiological signals that can affect the molecular clock mechanism (Govindarajan et al. 2016) and have been recognized as the natural ligands of nuclear receptors, especially farnesoid X receptor (Fxr, gene symbol Nrlh4), beyond their well-established roles in dietary lipid and nutrient absorption (Li and Chiang 2014; Zhou and Hylemon 2014). BAs exercise their modulated functions through activating Fxr to regulate the target transporters and enzymes at the transcriptional level to orchestrate various metabolic functions such as uptake, processing and detoxification of BAs, glucose, lipids and exogenous compounds (drugs) (Trauner et al. 2010; Gachon and Firsov 2011; Halilbasic et al. 2013; Kuipers et al. 2014). BAs in vivo originate from two sources, which are directly synthetized in hepatocytes and recycled via enterohepatic circulation. For synthesis (described in Figure 1), it has been reported that the mouse hepatic cholesterol 7α-hydroxylase cytochrome P450 7a1

(Cyp7a1) is the main rate-limiting enzyme mediating the biosynthesis of primary BAs, and then most of the BAs are mainly conjugated with taurine (T) in mice to excrete into bile (glycine (G)-conjugated BAs are the minor components in mice). Then, a portion of the primary BAs transform into secondary BAs by the bacteria in the intestine. For enterohepatic circulation, transporters in the liver and ileum mediate approximately 95% of the BAs’ reabsorption from the intestinal lumen into the circulatory system and reuptake into the hepatocytes for recycling. In detail (Figure 1), most of the conjugated BAs in the intestinal lumen are transported into enterocytes via apical sodium-dependent BA transporters (Asbt, Slc10a2), and then reabsorption into the hepatic portal blood is mediated by the basolateral heterodimeric organic solute transporters alpha and beta (Ostα/β, Slc51a/51b). At the basolateral membrane of the hepatocyte, Na +-taurocholate co-transporting polypeptide (Ntcp, Slc10a1) mediates the transport of most of the BAs from the portal venous blood into hepatocytes, and then more than 95% BAs, especially the conjugated BAs, are excreted into bile from hepatocyte, mainly

Figure 1. Schematic overview of regulatory interaction between BAs and enterohepatic enzymes and transporters systems. (1) Hepatic BA metabolic enzymes system: Cyp7a1 is the rate-limiting enzyme that mediates the synthesis of primary BAs from cholesterol; Cyp3a11, homologous as human CYP3A4, is the key enzyme determining the detoxification of BAs. (2) Hepatic transporters systems: Ntcp and Oatp2 mediate the uptake of BAs from the blood into hepatocyte; BAs actively secrete from hepatocytes into the bile by Bsep and Mrp2 at the canalicular membrane. (3) Ileal transporter systems of reabsorption: Asbt and Ostα/β are key transporters mediating transmembrane reabsorption of the majority of BAs from the intestinal lumen into the portal vein to ensure efficient BA enterohepatic circulation. (4) Fxrmediated “intestine-liver” regulatory axis: In hepatocytes, BAs activating Fxr indirectly inhibit the mRNA expression of Cyp7a1 and Ntcp through up-regulating Shp and directly up-regulate Bsep expression. In enterocytes, BAs activating Fxr up-regulate mRNA expression of Shp to repress Asbt transcription but promote gene expression of Ost?/?, and Fxr activating also increases the mRNA expression of Fgf15, which releases into the hepatic portal vein and then reaches the membrane of hepatocytes to repress the transcriptional expression of Cyp7a1.

CHRONOBIOLOGY INTERNATIONAL

via a bile salt export pump (Bsep, Abcb11). Furthermore, mRNA expressions of the enterohepatic transporter and enzyme systems mentioned above are principally regulated at the transcriptional level through BAs activating the central ligand-activated Fxr signaling pathway in the liver and ileum. Commonly, as described in Figure 1, in the hepatocyte, BAs activating Fxr inhibit the mRNA expression of Cyp7a1 and Ntcp indirectly through up-regulating the small heterodimer partner (Shp, Nr0b2) and promote Bsep gene expression directly. In the enterocyte, BAs activating Fxr up-regulate Shp to repress the Asbt gene expression indirectly but induce the gene expression of Ostα/β directly. Importantly, ileal Fxr activation promotes the gene transcription of fibroblast growth factor 15 (Fgf15, human FGF19), which releases into the hepatic portal vein and then reaches the membrane of the hepatocyte to repress the transcriptional expression of Cyp7a1, and this process is the so-called enterohepatic negative feedback regulation pathway (De Aguiar Vallim et al. 2013; Li and Chiang 2013; Brown & Sharpe, 2016). Additionally, except for the major genes described above, Cyp3a11 (homologous as human CYP3A4), organic anion transporting polypeptide 2 (Oatp2, Slc21a10) and multidrug resistance-associated protein 2 (Mrp2, Abcc2) also contribute to the BAs detoxification, hepatic uptake and biliary efflux in mice, and more importantly, they play a key role in drugs pharmacokinetics. For instance, CYP3A11 (homologues as Cyp3A4 in human) belongs to the Cyp3a subfamily, which accounts for up to 50% of the oxidative drug metabolism (Froy 2009; Chen et al. 2014; Werk and Cascorbi 2014). Thus, apparently, similar to circadian rhythms of BAs, the relevant transporter and enzyme systems fluctuate over the diurnal cycle with a circadian periodicity, and this may influence the daily homeostasis. Here, disruption of the BAs’ circadian clock may provide a diurnal activation of Fxr, which could, in turn, exert alternation of circadian regulation on its target transporter and enzyme at the transcriptional level, and this would cause metabolic diseases and chronopharmacology alternation or might exacerbate pathological states (Gachon and Firsov 2011). Cholecystectomy, the best and most effective treatment for gallbladder diseases, is one of the most frequently performed abdominal surgeries worldwide. Under physiological conditions, the

3

gallbladder handles up to 80% or more of the bile secreted by the liver, and it is well known that the circadian cycle of gallbladder filling and emptying controls the flow of bile into the intestine and the enterohepatic circulation of BA, which plays a pivotal role in regulating the physiological homeostasis (Housset et al. 2016). It has been demonstrated that long-term medical consequences of cholecystectomy would increase the risk of non-alcoholic fatty liver disease, diarrhea and colon cancer (Siddiqui et al. 2009; Nervi and Arrese 2013; Ruhl and Everhart 2013; Housset et al. 2016; Ridlon et al. 2016). Thereby, it is also plausible to postulate that the resection of gallbladder has a crucial effect on the circadian rhythms of BAs and could even cause the alternation on the circadian clock of BAs’ relevant transporters and enzymes; these more probably would be the key contributors leading to the relevant disorders and the chronopharmacology alternation of drugs in vivo after cholecystectomy (Housset et al. 2016; Ridlon et al. 2016). Taken together, we presumed that gallbladder ablation would lead to alteration of the circadian rhythms of BAs, enterohepatic transporter, enzyme systems and the Fxr signaling pathway. To address this issue, the present study was designed to clarify the circadian rhythms of BA concentration and composition and the time-ofday mRNA expression of the genes involved in BA transportation, metabolism and regulation in mice without gallbladders. The results of this study would provide insights into BA transportation and metabolism in generating the enterohepatic circadian rhythms and describe the roles of BA signaling in the diurnal regulation of the relevant transporters and enzymes after cholecystectomy; we expect to provide a cue for the rational clinical treatment for patients with cholecystectomy preliminarily.

Material and methods Animals and cholecystectomy

All animal procedures were approved by the Ethical Committee for Animal Experiments of Lanzhou University and were carried out in

4

F. ZHANG ET AL.

accordance with the guidelines of the Lanzhou University Ethics Review Committee. Male Kunming mice (around 20 g body weight) were used for experiments and were housed in a controlled temperature (25 °C) and a 12:12-h light/ dark cycle (light schedule: 7:00 AM−7:00 PM) and permitted ad libitum consumption of water and a standard mouse diet for one week of the acclimation period. The cholecystectomized surgery was executed as in our previous study (Zhang et al. 2017). Briefly, all mice were anesthetized with urethane intraperitoneally, and then the abdominal wall muscle was divided. After the gallbladder was removed by gentle dissection, the subcostal abdominal and skin incisions were closed. Sham operation was performed in a similar manner, except that the gallbladder was not dissected. The whole process of operation was performed under sterile conditions, and antibiotics were applied to the wounds at the end. After surgery, all mice recovered under normal conditions, were fed with food and water ad libitum, and were weighed along the observational period for two weeks until experiments were executed. Sample collection from mice

After two weeks of operation, specimens of liver, small intestine – including duodenum, jejunum and ileum and its contents – ileum and/or gallbladder were usually obtained after 6 h of fasting as well as at 6-hour intervals over 24 hours, which is from 7:00 AM to the next 7:00 AM. Tissue specimens were collected after the animals were euthanized with an overdose of anesthesia. All the samples mentioned above for BA analysis were quickly frozen in −80 °C until further use. Furthermore, samples of liver and ileum tissue for real-time quantitative PCR (RT-qPCR) analysis were quickly frozen in liquid nitrogen for subsequent mRNA expression determination. Total BA analysis and HPLC/MS/MS quantification of individual BAs

Total BA levels in the liver, gallbladder and the whole small intestine and its contents (n = 5 per group) were measured separately a kit from Nanjing Jiancheng

Bioengineering institute (Nanjing, China) and detected by a Chemistry Analyzer (OLYMPUS AU400, Tokyo, Japan). BA pool size was determined as the total mass of BA extracted from liver, gallbladder and the whole small intestine, including its contents. For focusing on the circadian rhythms of major individual BA concentrations and compositions in vivo, the concentration of unconjugated primary BA cholic acid (CA), chenodeoxycholic acid (CDCA), βmuricholic acid (β-MCA) and ursodeoxycholic acid (UDCA) in mice (Sayin et al. 2013), secondary BA deoxycholic acid (DCA), lithocholic acid (LCA) and hyodesoxycholic acid (HDCA), and their glycine(G) and taurine (T)-conjugated BAs in liver and ileum (n = 5 per group) were determined by HPLC/MS/MS (Agilent, Palo Alto, USA). H2CDCA and demethylation deoxycholic acid (NDCA) were added as the internal standards. All individual BAs and internal standards were purchased from Sigma-Aldrich Company (St. Louis, MO). RNA extraction and real-time quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from frozen liver and ileum tissue separately (n = 5 per group) using the RNAprep Pure Tissue Kit (TianGen Biotech Corporation, LTD, Beijing, China) according to the manufacturer’s instructions. In total, 1 μg mRNA was reverse transcribed to cDNA using the FastQuant RT Kit (TianGen Biotech Corporation, LTD, Beijing, China). RT-qPCR was performed using FastStart Essential DNA Green Master (Roche, Basel, Switzerland). Sequences for the primers are listed in Table 1. Gapdh as the housekeeping genes was used to normalize expression. Commercially available TaqMan assays were used on a 480-qPCR Light Cycler (Roche, Basel, Switzerland). Statistical methods

All data were reported as arithmetic means ± standard deviations (S.D.). For statistical analysis, two-tailed Student’s T-test was used to address variance analysis of unpaired samples and to compare the mRNA level of transporters and enzymes between different time-of-day

CHRONOBIOLOGY INTERNATIONAL

5

Table 1. Primer sequences used for RT-qPCR. Primer Fxr Shp Fgf15 Cyp7a1 Cyp3a11 Ntcp Oatp2 Bsep Mrp2 Asbt Ostα Ostβ Gapdh

Forward sequence GGAACTCCGGACATTCAAC CGATCCTCTTCAACCCAGATG GAGGACCAAAACGAACGAAATT GAAGGCATTTGGACACAGAAGC CTGACAAACAAGCAGGGATG ACTGGCTTCCTGATGGGCTAC AACTGTTTGCCCCTCAGCCT CAATGTTCAGTTCCTCCGTTCA ACTATCGCACACAGGCTGCAC TGGGTTTCTTCCTGGCTAGACT TACAAGAACACCCTTTGCCC GTATTTTCGTGCAGAAGATGCG TGTGTCCGTCGTGGATCTGA

Reverse sequence GTGTCCATCACTGCACATC AGGGCTCCAAGACTTCACACA ACGTCCTTGATGGCAATCG AACACAGAGCATCTCCCTGGA CCAAGCTGATTGCTAGGAGCAC GAGTTGGACGTTTTGGAATCCT TTCTTTTCTCCTGCCATGTTGA TCTCTTTGGTGTTGTCCCCATA GGGACCCATATTGGACAGCA TGTTCTGCATTCCAGTTTCCAA CGAGGAATCCAGAGACCAAA TTTCTGTTTGCCAGGATGCTC CCTGCTTCACCACCTTCTTGAT

Fxr, farnesoid X receptor; Shp: small heterodimer partner; Fgf15, fibroblast growth factor 15; Cyp7a1, cholesterol 7αhydroxylase cytochrome P450 7a1; Cyp3a11, cytochrome P450 3a11; Ntcp, Na+-taurocholate co-transporting polypeptide; Oatp2, organic anion transporting polypeptide 2; Bsep, bile salt export pump; Mrp2, multidrug resistance-associated protein 2; Asbt, apical sodium-dependent bile acids transporter; Ostα/β, heterodimeric organic solute transporters alpha and beta; Gapdh as the housekeeping gene was used to normalize expression.

stages. The AUC24h of BAs (area under the 24hour BA concentration time curve), which represents the daily amount of BAs, was calculated by Drug and Statistic 2.0 (DAS 2.0) pharmacokinetic software (Chinese Pharmacological Association, Anhui, China). For all tests, p values < 0.05 and < 0.01 were considered statistically significant and very significantly different, respectively. Results Circadian rhythms of total BA pool were attenuated after cholecystectomy

In the present study, the BA pool consists of the total BAs in the liver, gallbladder and the whole intestine including the intestinal content, which reflects the circadian rhythm of the integral BAs in vivo. As described in Figure 2, it was observed that in the sham-operated mice, the total BA pool exhibited a significant circadian rhythm during 24 hours as compared with the cholecystectomized mice. More concretely, the pool size of mice with gallbladder was the lowest in the early evening at 7:00 PM, which is also the point at the beginning of the dark, and then began to elevate and peaked in the middle of the dark phase (1:00 AM) and the light phase (1:00 PM). In contrast, the gallbladder resection resulted in flattened diurnal peaks of BA pool size (Figure 2), and it was observed that the BA pool size was remarkably lower in sham-operated

mice both at 1:00 AM and at 1:00 PM. Moreover, the area under the 24-hour BA concentration time curve (AUC24h) of the BA pool, which means the total BA pool concentration during 24 hours, was dramatically reduced from 2384.87 ± 242.64 nmol/g (body weight)/h to 1995.96 ± 242.64 nmol/g (body weight)/h after cholecystectomy, as compared with the shamoperated group. Collectively, this finding suggested that the circadian rhythm of the total BA pool was attenuated and the 24-hour BA pool size was pronouncedly reduced following cholecystectomy in mice.

Circadian rhythms of hepatic BAs were flattened in cholecystectomized mice

Liver integrated into the “intestine-liver axis” is mainly responsible for BA synthesis. In the sham-operated group, the hepatic total BAs showed totally distinct circadian rhythm from the BA pool, the highest peak of which was at 7:00 PM, and the second peak appeared after 12 hours at 7:00 AM, and the valley value turned up at 1:00 AM and 1:00 PM, and the concentration at 1:00 AM reached the lowest point (data are shown in Figure 2). Additionally, the hepatic primary BAs that are directly synthetized by the liver and account for more than 95% of the total BAs, and the conjugated BAs, mainly as the T-conjugated BAs that are about approximately 90% of the hepatic

6

F. ZHANG ET AL.

Figure 2. Circadian rhythms of BA pool size (nmol per g of body weight) and circadian rhythms of concentration for total BAs, primary BAs, secondary BAs, conjugated and unconjugated BAs and Fxr agonists and non-agonists in the liver (μg per g of liver tissue). All data are expressed as mean ± S.D. (n = 5 per group). *p < 0.05 and **p < 0.01 indicate statistically significant difference between cholecystectomized mice versus sham-operated mice.

total BAs in the liver (the G-conjugated BAs as the minor components in mice were all not found because of levels < the limits of quantitation of HPLC/MS/MS), exhibited similar circadian variations as the total BAs in the liver (Figure 2). Moreover, the concentration of secondary BAs and unconjugated BAs also exhibited the similar variation rhythms as the total BAs in liver of sham-operated mice, except for the lowest concentration shifted from 1:00 AM to 1:00 PM (Figure 2). Furthermore, considering that Fxr agonists are important signaling molecules activating Fxr to regulate the downstream gene at transcription, the circadian rhythms were also determined. As a result, the Fxr agonists had a pronounced circadian peak

at 7:00 PM and a minor peak at 7:00 AM, and had two valleys at 1:00 AM and 1:00 PM, respectively (Figure 2). In addition to the Fxr agonists, the non-agonists concentration exhibited a similar circadian rhythm. In the cholecystectomized group, compared with the sham-operated mice, flattened diurnal fluctuation for all kinds of BAs mentioned above in the liver, including total, primary, secondary, conjugated and unconjugated, and Fxr agonists and non-agonists BAs, was observed (Figure 2). Furthermore, the major components of BAs, primary and conjugated BAs, and the Fxr agonists and non-agonists in the liver of cholecystectomized mice showed similar daily fluctuations with the total BAs, the concentration of which did not show significant peak and valley and

CHRONOBIOLOGY INTERNATIONAL

was just slightly higher at 1:00 PM. Distinctively, the secondary BA concentration curve showed a valley at 1:00 PM and had the highest concentration at 7:00 PM; the peak concentration of the unconjugated BAs shifted to 7:00 AM compared to the total BAs (Figure 2). Nevertheless, the AUC24h of most kinds of BAs in the liver had no significant changes after gallbladder resection, except that the AUC24h of Fxr non-agonists decreased to half of that in sham-operated mice (data shown in Table 2). Most concentrations of hepatic individual BAs, including CA, TCA, CDCA, β-MCA, Tβ-MCA, UDCA, TUDCA, HDCA and THDCA in the shamoperated group, and the concentrations of CDCA and T-conjugated primary BAs, including TCA, Tβ-MCA and TUDCA in the cholecystectomized group, both exhibited similar diurnal rhythm as their corresponding total BAs (Figure 3). Otherwise, distinct from the hepatic total BAs, in sham-operated mice, the daily

7

concentration of TCDCA and DCA exhibited only one valley value at 1:00 PM, as described in Figure 3. In cholecystectomized mice, except for the individual BAs mentioned above, other individual BAs exhibited distinct circadian rhythms in the liver (Figure 3). The concentration peaks of CA and TCDCA, respectively, were observed at 7:00 AM and 1:00 AM, and the concentration curves of DCA and TDCA showed notable valleys only at 1:00 PM and 7:00 AM, respectively; the diurnal fluctuations of β-MCA, UDCA, HDCA, and THDCA were flattened (Figure 3). Collectively, as compared with the sham-operated group, the AUC24h of all of the hepatic individual BAs had no significant difference between sham-operated and cholecystectomized mice (detailed data shown in Table 2). The composition of CAs was significantly reduced associated with the increased composition of β-MCAs at 1:00 AM in sham-operated mice

Figure 3. Circadian rhythms of individual BAs concentration in the liver (μg per g of liver tissue). All data are expressed as mean ± S. D. (n = 5 per group). *p < 0.05 and **p < 0.01 indicate statistically significant difference between cholecystectomized mice versus sham-operated mice. Concentration levels of individual BAs below the limits of quantitation of HPLC/MS/MS were not found and not shown.

8

F. ZHANG ET AL.

Table 2. The area under the 24-hour BA concentration time curve (AUC24h) that reflects the total concentration during 24 hours for different kinds of BAs in the liver and ileum. AUC24h (mg/g/h) In liver Bile acids Total BAs Primary BAs Secondary BAs Conjugated BAs Unconjugated BAs Fxr agonists Fxr non-agonists CA TCA CDCA TCDCA β-MCA Tβ-MCA UDCA TUDCA DCA TDCA HDCA THDCA

Sham 7.172 ± 1.545 7.053 ± 1.523 0.119 ± 0.027 6.213 ± 1.355 0.960 ± 0.220 2.297 ± 0.718 7.345 ± 1.279 0.614 ± 0.159 1.504 ± 0.540 0.033 ± 0.005 0.075 ± 0.014 0.178 ± 0.041 4.586 ± 0.939 0.039 ± 0.008 0.024 ± 0.005 0.041 ± 0.013 0.030 ± 0.012 0.013 ± 0.002 0.036 ± 0.008

In ileum Cholecystectomy 6.993 ± 1.386 6.858 ± 1.373 0.134 ± 0.016 6.022 ± 1.292 0.972 ± 0.261 2.247 ± 0.554 4.745 ± 0.992 * 0.587 ± 0.197 1.459 ± 0.397 0.035 ± 0.011 0.076 ± 0.005 0.210 ± 0.066 4.437 ± 0.976 0.031 ± 0.007 0.025 ± 0.008 0.056 ± 0.007 0.034 ± 0.007 0.012 ± 0.003 0.031 ± 0.007

Sham 10.586 ± 1.857 10.448 ± 1.835 0.138 ± 0.029 10.267 ± 1.791 0.319 ± 0.090 5.436 ± 1.301 5.150 ± 0.671 0.205 ± 0.062 4.986 ± 1.217 0.003 ± 0.001 0.121 ± 0.033 0.107 ± 0.034 5.163 ± 0.775 Not Found 0.016 ± 0.007 0.004 ± 0.001 0.116 ± 0.025 Not Found 0.017 ± 0.005

Cholecystectomy 7.021 ± 0.853 ** 6.896 ± 0.829 ** 0.124 ± 0.027 6.889 ± 0.826 ** 0.131 ± 0.034 ** 3.087 ± 0.511 ** 3.934 ± 0.373 ** 0.072 ± 0.022 ** 2.833 ± 0.477 ** 0.002 ± 0.0003 ** 0.070 ± 0.010 * 0.060 ± 0.012 * 3.846 ± 0.358 ** Not Found 0.019 ± 0.003 0.003 ± 0.001 0.106 ± 0.024 Not Found 0.015 ± 0.004

AUC24h, area under the 24-hour BAs concentration time curve; BAs, bile acids; CA, cholic acid; CDCA, chenodeoxycholic acid; β-MCA, β-muricholic acid; UDCA, ursodeoxycholic acid; DCA, deoxycholic acid; HDCA, hyodesoxycholic acid; T-, taurine conjugated bile acid. All AUC24h (mg per g of tissue weight per hour) are expressed as mean ± S.D. (n = 5 per group). *p < 0.05, **p < 0.01 indicate statistically significant difference between cholecystectomized mice versus sham-operated mice. Concentration levels of individual BAs below the limits of quantitation of HPLC/MS/MS were not found and are not shown.

(Figure 4) as compared with the BA compositions at others time points. Except for that, the hepatic individual BA compositions maintained a constant range from dark to light in both sham-operated and cholecystectomy groups (details depicted in Figure 4). In addition, compared to the shamoperated mice, all of the compositions of BAs had no significant statistical change in mice following cholecystectomy for 2 weeks (Figure 4). Take together, in mice with gallbladder, most of the BAs in liver exhibited obvious light/dark circadian variations, which were low at 1:00 AM and 1:00 PM and high at 7:00 PM and 7:00 AM. Comparatively, these circadian variations were profoundly flattened by the gallbladder resection, but the composition and daily amount of individual BAs had no significant alternation between sham-operated and cholecystectomized mice. Circadian rhythms of ileal BAs were flattened and the 24-hour total concentration in ileum was decreased in cholecystectomized mice

Ileum mediates more than 95% BAs reabsorption and is the pivotal element of enterohepatic

circulation; it integrates into the “intestine-liver axis” to regulate BA homeostasis in vivo. In the present study, it had been observed that the ileal BA concentration exhibited remarkable daily circadian rhythm in mice with gallbladder (Figure 5). The concentration of the major BA components, primary and conjugated BAs and the concentration of Fxr agonists and non-agonists all showed similar 24-hour fluctuations as the total BA concentration in ileum, which peaked at 1:00 AM and 1:00 PM and reached the lowest level at 7:00 PM and 7:00 AM. Furthermore, the average concentration had no great difference between dark (from 7:00 PM to 7:00 AM) and light phases (from 7:00 AM to 7:00 PM) (described in Figure 5). Nevertheless, the concentrations of ileal secondary and unconjugated BAs were described as distinct 24-hour rhythms that had only one pronounced circadian peak. The secondary BA concentration was the highest during the early-light phase at 7:00 AM, and its oscillation from dark to light had no significant difference (Figure 5). The unconjugated BA concentration was the highest in the middle of the night (1:00 AM), which resulted

CHRONOBIOLOGY INTERNATIONAL

9

Figure 4. BA composition in the liver at different times from 7:00 PM to 1:00 PM. All data are expressed as mean ± S.D. (n = 5 per group). *p < 0.05, **p < 0.01 indicate statistically significant difference between cholecystectomized mice versus sham-operated mice.

in its level being higher during the dark phase than during the light phase (Figure 5). As described in Figure 5, gallbladder resection resulted in considerable decreases of concentration of total, primary and conjugated BAs and Fxr agonists and non-agonists at 1:00 AM and 1:00 PM, which contributed to the flattened circadian rhythms in the ileum in mice with cholecystectomy for 2 weeks. Similarly, the ileal circadian rhythms of the secondary and unconjugated BA concentration were also flattened, which showed that the highest concentration was significantly reduced after cholecystectomy as compared with sham-operated mice (Figure 5). Obviously, the AUC24h of most kinds of BAs mentioned above, except for the secondary BAs in the ileum, were remarkably decreased after cholecystectomy versus the sham-operated group (data shown in Table 2). In the ileum of mice with gallbladder, the concentration of the predominant primary BAs, including TCA (40%) and Tβ-MCA (50%), showed similar

circadian variations as that of the ileal total BAs described above (Figure 6), and had two circadian peaks at 1:00 AM and 1:00 PM, respectively. Except for the TUDCA, the peak concentrations of the other minor primary BAs involved in CA, CDCA, TCDCA and β-MCA at 1:00 PM were notably reduced compared with that of TCA and Tβ-MCA, and they presented only one daily peak at 1:00 AM. In addition, the concentration of ileal secondary BAs, including DCA, TDCA and THDCA, in sham-operated mice exhibited different circadian fluctuations, the details of which are shown in Figure 6. Furthermore, after two weeks of cholecystectomy in mice, except TUDCA, the concentration peaks of all kinds of primary BAs in the ileum were reduced, which resulted in flat circadian rhythms compared with the sham-operated mice (Figure 6). The 24-hour concentration fluctuation of TUDCA and the secondary BAs including DCA, TDCA and THDCA had distinct alternation in cholecystectomized mice versus sham-operated mice. In details, the daily concentration curve of TUDCA and

10

F. ZHANG ET AL.

Figure 5. Circadian rhythms of concentration for total BAs, primary BAs, secondary BAs, conjugated and unconjugated BAs and Fxr agonists and non-agonists in the ileum (μg per g of ileum tissue). All data are expressed as mean ± S.D. (n = 5 per group). *p < 0.05 and ** p< 0.01 indicate statistically significant difference between cholecystectomized mice versus sham-operated mice.

THDCA in mice with gallbladder resection was similar to that in sham-operated mice, and the concentrations of DCA and TDCA at 7:00 AM were significantly decreased after cholecystectomy (Figure 6). Altogether, the AUC24h of the primary individual BAs in ileum, including CA, TCA, CDCA, TCDCA, β-MCA and Tβ-MCA, were profoundly decreased following cholecystectomy for two weeks versus the sham-operation group (data shown in Table 2). For the BA composition in the ileum, in the shamoperated group, the CAs and β-MCAs were the predominant BAs and their compositions remained within approximately 40%–50% from dark to light (Figure 7). In the cholecystectomy group, the ileal compositions of CAs and β-MCAs in the light phase were, respectively, lower and higher than those in the dark phase. Especially, in the early morning (7:00 AM), the CA composition was decreased to 32%

from the average composition of 45% during the dark phase (Figure 7). Compared to the sham-operated group, after cholecystectomy, except for at 7:00 PM, the compositions of CAs and β-MCAs were, respectively, decreased and increased, but they did not reach significant statistical difference (Figure 7). Taken together, these results suggested that the circadian rhythms of ileal BAs were flattened and the 24-hour total concentration was profoundly decreased after cholecystectomy in mice, but the ileal composition of individual BAs had no significant change.

Cholecystectomy altered the circadian rhythm of mRNA expression of genes involved in BA transportation and metabolism in the liver

To further delineate the role of the alternation of circadian variations of the BA concentration after

CHRONOBIOLOGY INTERNATIONAL

11

Figure 6. Circadian rhythms of individual BA concentration in the ileum (μg per g of ileum tissue). All data are expressed as mean ± S.D. (n = 5 per group). *p < 0.05 and **p < 0.01 indicate statistically significant difference between cholecystectomized mice versus sham-operated mice. Concentration levels of individual BAs below the limits of quantitation of HPLC/MS/MS were not found and are not shown.

cholecystectomy in regulating the circadian rhythms of BA-related genes, comparisons were made on the mRNA expression of hepatic uptake transporters Ntcp and Oatp2, efflux transporters Bsep and Mrp2, biosynthetic enzyme Cyp7a1, metabolism enzyme Cyp3a11 (human CYP3A4), and Fxr signaling pathway including Shp in the liver (Figure 1). In sham-operated mice, hepatic Fxr mRNA was the highest at dark and light starting times (7:00 PM and 7:00 AM) and was the lowest at the middle dark and light phases (1:00 AM and 1:00 PM). After cholecystectomy, the circadian pattern of Fxr mRNA expression shifted a 6-hour interval over the 24-hour cycle as compared with sham-operated mice, which exhibited circadian peaks at 1:00 AM and 1:00 PM and circadian valleys at 7:00 PM and 7:00 AM, and the expressions at 1:00 PM and 1: 00 PM were significantly increased versus the shamoperated group (Figure 8). Shp mRNA showed a similar circadian pattern as the Fxr in the sham-

operated group, but its expression at 1:00 AM was remarkably up-regulated after cholecystectomy. Ntcp, Oatp2, Mrp2 and Cyp3a11 all showed the highest mRNA expressions in the early evening at 7:00 PM, and had the lowest expression at 1:00 PM, 1:00 AM, 7:00 AM and 1:00 AM in sham-operated mice. After cholecystectomy, Mrp2 and Cyp3a11 mRNA was evenly expressed throughout the 24hour time course; the expressions of Ntcp and Oatp2 at 1:00 PM were significantly up-regulated and the Oatp2 expression at 7:00 PM was notably down-regulated (Figure 8). Bsep mRNA expression exhibited a similar circadian rhythm between the sham-operated and cholecystectomy groups, but its 24-hour expression was profoundly decreased after cholecystectomy when compared to sham-operated mice. Cyp7a1 mRNA down-regulated rapidly to the lowest level (1:00 AM) after the onset of the highest at 7:00 PM, and then slightly up-regulated from 7:00 PM to 1:00 PM in sham-operated mice, but this

12

F. ZHANG ET AL.

Figure 7. BA composition in the ileum at different times from 7:00 PM to 1:00 PM. All data are expressed as mean ± S.D. (n = 5 per group). *p < 0.05 and **p < 0.01 indicate statistically significant difference between cholecystectomized mice versus sham-operated mice.

circadian fluctuation was significantly attenuated after cholecystectomy (Figure 8). For the 24-hour mRNA expression of all these genes, in comparison with sham-operated mice, the Shp average expression was increased, but the expressions of Bsep, Mrp2 and Cyp3a11 were decreased; moreover, the other genes expression had no significant difference after cholecystectomy. Taken together, these findings suggested that the circadian rhythms of hepatic relevant genes expression were altered in mice with cholecystectomy. Cholecystectomy had an effect on the circadian rhythms of mRNA expression of genes involved in Fxr signaling in the ileum

In the ileum, the pivotal position for BA reabsorption, more than 95% of BAs are reclaimed from the terminal ileum into the portal blood and then

recirculate to the liver for recycling. This reabsorption principally mediates by Asbt and Ostα/β in ileal enterocytes. Additionally, ileal Fxr-Fgf15 (human FGF19) signaling pathway integrated into “intestine-liver axis” is the crucial site for the negative feedback regulation of hepatic synthesis of BAs (Figure 1). In mice with gallbladder (data shown in Figure 9), the ileal mRNA expression of Fxr exhibited a minor valley in the middle of the night at 1:00 AM. In the middle of the day (1:00 PM), the mRNA was significantly upregulated after cholecystectomy, which resulted in the Fxr mRNA expression being higher during light than dark in mice without gallbladder; even the 24-hour expression amount of Fxr was higher than that in the sham-operated group. Shp mRNA expression in the ileum of mice with gallbladder showed a pronounced diurnal

CHRONOBIOLOGY INTERNATIONAL

13

Figure 8. Circadian rhythms of mRNA expression for the Fxr-Shp signaling pathway and the BAs transporters and enzymes systems in the liver. The mRNA expressions were normalized to Gapdh expression. All data are expressed as mean ± S.D. (n = 5 per group). *p < 0.05 and **p < 0.01 indicate statistically significant difference between cholecystectomized mice versus sham-operated mice.

peak at 1:00 AM at night, which contributed to the expression being higher than that in the day. In contrast, Shp mRNA expression in the day was higher than that in the night after gallbladder resection, which ascribed to the diurnal peak being shifted to 1:00 PM. In addition, in the ileum of sham-operated mice, Fgf15 mRNA exhibited a similar circadian rhythm as Shp, but after cholecystectomy, its expression was profoundly decreased by 85.5% compared with the peak expression at 1:00 AM in shamoperated mice. Thus, the daily mRNA expression of Fgf15 was significantly down-regulated in cholecystectomized mice versus sham-operated mice. mRNA expressions of the ileal BA uptake transporters, Asbt and Ostα/β, exhibited specific circadian rhythms in mice with

gallbladder, and cholecystectomy had no considerable effect on their circadian rhythm and on the 24-hour mRNA expression amount. Taken together, the circadian rhythms of the ileal Fxr signaling pathway, including Shp and Fgf15, altered after cholecystectomy. Discussion Daily rhythms involved in BAs, transporters, enzymes and their regulatory pathways after cholecystectomy have received relatively little attention. As such, in the present study, we investigated the effect of cholecystectomy on the circadian rhythms for the BA concentration and composition, the mRNA expression of BA-relevant transporters and enzymes systems and the

14

F. ZHANG ET AL.

Figure 9. Circadian rhythms of mRNA expression for the Fxr-Shp/Fgf15 signaling pathway and the BAs transporters systems in the ileum. The mRNA expression was normalized to Gapdh expression. All data are expressed as mean ± S.D. (n = 5 per group). *p < 0.05 and **p < 0.01 indicate statistically significant difference between cholecystectomized mice versus sham-operated mice.

Fxr regulatory signaling pathways in the liver and ileum of mice. In general, the current study demonstrates that: (1) mice with gallbladder exhibited significant circadian oscillations in the BA pool as well as hepatic and ileal BAs during gallbladder emptying period (1:00 AM and 1:00 PM), despite food being restricted during these periods; (2) in the liver of mice with gallbladder, the circadian rhythms of BAs could ascribe to the circadian variation of Cyp7a1, which is mainly regulated by the ileal Fxr-Fgf15-Cyp7a1 negative feedback pathway rather than the hepatic FxrShp-Cyp7a1 suppression pathway; (3) the circadian rhythmicity of the BA pool and hepatic and ileal BAs diminished, but the BA composition had no significant alteration in the liver and ileum after cholecystectomy as compared with sham-operated mice; (4) in parallel to the alteration of BA levels in the liver and ileum after cholecystectomy, the day/night circadian oscillations in the mRNA expression of the relevant transporting and metabolic genes and the Fxr

signaling pathway-mediated “intestine-liver” regulatory axis also shifted. It has been reported that time-restricted feeding enhanced the daily rhythm in plasma BA concentrations (Eggink et al. 2017). Mice with gallbladders on a time-restricted feeding in our study (6hour interval fasting schedule before every experimental time point) showed a significant day/night rhythm in BA pool size, which peaked during night at 1:00 AM and in day at 1:00 PM as seen in the gallbladder-emptying periods observed in sham-operated mice in the current study. BA pool in vivo originates from two sources, which are directly synthetized by hepatocytes and recycling via enterohepatic circulation. Thus, as our results showed, the acrophase of BA pool size should ascribe to the increased reabsorption of BAs from the ileum rather than the decreased hepatic BA biosynthesis (Figures 2 and 5). In addition, it has been demonstrated that the regulation of gallbladder filling and emptying is closely linked not only to the feeding/fasting cycle but also to the

CHRONOBIOLOGY INTERNATIONAL

dark/light cycle (Housset et al. 2016). Here, despite the sham-operated mice being under fasting condition, the filling/emptying rhythm of gallbladders still exists, and this contributed to the BAs being restored in the gallbladder and releasing into the ileum and then resulting in the increased ileal reabsorption of BAs at 1:00 AM and 1:00 PM; this synchronously inhibited the hepatic BA synthesis via BAs activating the ileal Fxr-Fgf15-hepatic Cyp7a1 pathway (the details were described as follows). This finding is similar to the previous findings in mice from the studies of Ma K et al., Li T et al. and Zhang YK et al., demonstrating that the plasma BA concentrations that mainly reabsorb from the distal ileum are high during the feeding period, irrespective of whether food intake takes place during the normal dark phase, the light phase or after a fasting period (Ma et al. 2009; Zhang et al. 2011; Li et al. 2012). Altogether, the mice with gallbladder exhibited significant oscillations in the BA pool as well as hepatic and ileal BAs at 1:00 AM and 1:00 PM could be entrained by the day/night clock of gallbladder emptying cycle, despite food being restricted during these periods. As expected, the circadian rhythmicity of the BA pool was flattened under the circumstance of no gallbladder emptying cycle after gallbladder resection. Furthermore, the 24-hour BA pool size was profoundly decreased after cholecystectomy, which is in accordance with the findings in another review (Housset et al. 2016) and is a result of BA malabsorption, which has been demonstrated in our previous study in mice with cholecystectomy (Zhang et al. 2017). Liver is the pivotal organ to determine the BA homeostasis, especially the biosynthesis of primary BAs. For clarity, data related to the circadian rhythmicity in mice with gallbladder is discussed first, followed by a section describing the results of cholecystectomized mice. It has been observed in the current study that most of the hepatic BAs, including total, primary, secondary, conjugated and unconjugated BAs and Fxr agonist and non-agonist in mice with gallbladder showed significantly lower levels at night 1:00 AM and day 1:00 PM and reached a peak at 7:00 PM. To address the mechanisms in response to this circadian rhythms pattern, three key genes determining BA concentration in the liver – Ntcp, mediating more than 95% BAs

15

uptake into hepatocyte; Bsep, the major gene exporting the conjugated BAs that account for more than 90% of the total BAs into bile; and Cyp7a1, limiting the primary BAs hepatic synthesis (Figure 1) (Brown & Sharpe, 2016; Thakkar et al. 2017) – were measured. Indeed, our present data suggested that the similar rhythmicity of Cyp7a1 gene expression with the hepatic BAs principally results in the day/night variations of hepatic BAs in mice with gallbladder (Figures 2 and 8). It has been reported that two Fxr signaling pathways regulate Cyp7a1 expression at the transcriptional level (the pathways are described in Figure 1). In the liver, Fxr activated by BAs inducing the expression of Shp has a suppression effect on the gene expression of Cyp7a1, the so-called hepatic Fxr-ShpCyp7a1 pathway. In the ileum, BAs activating Fxr to induce Fgf15 release into the portal vein, and subsequently result in the repression of Cyp7a1 when Fgf15 reaches the surface of the hepatocyte, the so-called enterohepatic Fxr-Fgf15-Cyp7a1 negative feedback pathway (Lefebvre et al. 2009; Jonker et al. 2012). In the current study, the results suggested that the mRNA expression of Fxr and Shp and the concentration of Fxr agonists in the liver exhibited accordant daily rhythms, which satisfied the regulatory discipline from Fxr to Shp, with Fxr being activated by agonists directly inducing the Shp transcription. Thus, it seems that the circadian variation of Cyp7a1 mRNA should be totally different from that of Fxr and Shp, exhibiting expression valleys at 7:00 PM and peaks at 1:00 AM and 1:00 PM, because the activating hepatic Fxr-Shp suppresses Cyp7a1 expression at the transcriptional level. Practically, the circadian rhythm of Cyp7a1 mRNA still showed a similar pattern with Fxr and Shp in our results, and this finding is consistent with the study from Lu YF and colleagues (Lu et al. 2013). More specifically, it has been reported that the hepatic Cyp7a1 repression depends mainly on ileal Fxr activation via Fgf15 (Kim et al. 2007; Zhu et al. 2011). Consequently, we propose that the Cyp7a1 expression oscillations should result from the activation of the ileal Fxr-Fgf15 pathway. As expected, at 1:00 AM and 1:00 PM, the concentrations of BAs, especially the Fxr agonists in the ileum, were significantly elevated because of the gallbladder constriction to release the stored BAs into the intestine (Figure 5), which activated the Fxr

16

F. ZHANG ET AL.

to induce Fgf15 transcription and then efficiently depressed the hepatic Cyp7a1 gene expression to exactly lead to the daily oscillations of hepatic Cyp7a1 mRNA expression (Figures 8 and 9). Collectively, in the liver of mice with gallbladder, the circadian rhythm of BAs could be ascribed to the Cyp7a1 circadian variation, which is mainly regulated by the ileal Fxr-Fgf15-Cyp7a1 negative feedback pathway rather than the hepatic Fxr-ShpCyp7a1 suppression pathway. Additionally, in comparison to the mice with gallbladder, the flattened circadian rhythm of hepatic BA concentration associated with Cyp7a1 mRNA after cholecystectomy could be ascribed to the flattened daily oscillations of BA concentration and Ffg15 in the ileum (Figure 1, 2, 5, 6, 8 and 9). Moreover, for the original reason, it seems plausible that it is due to the continuous release of BAs into the intestine under the condition of no gallbladder filling and empting cycle after cholecystectomy. Noteworthy, most of the 24hour amount (AUC24h) and composition of BAs in the liver had no significant change after gallbladder resection compared with the sham-operated mice (Figure 1 and Table 2). The mechanisms responsible for the phenomena might be consistent with our previous finding that appear to be associated with the up-regulated 24-hour expression of Ntcp and significantly down-regulated 24-hour expression of Bsep (Figure 8), which leads hepatic BAs uptake increasing and efflux decreasing to prevent the most hepatic BAs from flowing away and to maintain the BA levels in the liver at a normal range in mice without gallbladders (Zhang et al. 2017). Fgf15 mRNA expression in the ileum of mice with gallbladder was higher during the dark than during the light (Figure 9), which is consistent with the finding from Zhang YK (Zhang et al. 2011). The possible explanation is that mouse, being a nocturnal animal, eats at night, which might contribute to the different BA compositions in the ileum between day and night. Thus, we speculated that the composition of BAs with higher lipophilicity promoting dietary lipid digestion should increase further during the feeding time (1:00 AM in our study). Indeed, the results from our study showed that the composition of hydrophobic BAs, including CAs and CDCAs, also as the Fxr potent agonists, was increased and the hydrophilic BAs (βMCAs), also as the non-agonists, were decreased as compared with that at daytime at 1:00 PM. According

to the Fgf15 regulation on hepatic Cyp7a1, the mRNA expression of Cyp7a1 was lower during dark than day in our result, but this finding seems to conflict with the findings from Amigo L et al., which indicated that the Cyp7a1 mRNA expression is higher during the dark phase than during the light phase (Amigo et al. 2011). Nonetheless, except for the animal strain, the 12:12-h light/dark cycle, time of samples collection and the fasting schedule and duration are different between the two studies. In our experiment, 7:00 AM to 7:00 PM was the light phase and the samples were, respectively, collected after 6 hours fasting at 1:00 AM (dark) and 1:00 PM (light), but in Amigo L et al.’s experiment, the samples were usually obtained after 2–3 h of fasting at the end of the dark phase (9:00 AM) and at the end of the light phase (9:00 PM). In addition, as compared with the sham-operated mice, the circadian rhythms of mRNA expression of Asbt and Ostα/β in the ileum of mice without gallbladder had no great alternation. It can be speculated that the ileal Asbt and Ostα/β might be regulated by the clock gene in brain and was barely affected by the BAs daily fluctuation. Regrettably, the relevant mechanisms on the circadian clock of Asbt and Ostα/β have not been fully illuminated. Anther focus of this study is to characterize the circadian rhythms of the genes greatly involved in drug pharmacokinetics. In the current, the daily rhythms of the mRNA expressions of hepatic Cyp3a11, Oatp2 and Mrp2, which have great relationship with the pharmacokinetics of common drugs in clinic, were determined. Based on the current findings, the mRNA circadian rhythms of Cyp3a11, Oatp2 and Mrp2 in the liver of cholecystectomized mice were totally distinct from those in sham-operated mice, and the 24-hour expression amounts of Cyp3a11 and Mrp2 were significantly decreased following cholecystectomy. Most importantly, these findings provide us a cue at least that having been subjected to a cholecystectomy might influence the chronopharmacology of drugs in vivo after cholecystectomy. In summary, the BAs and the corresponding genes involved in BA homeostasis included the relevant transporters, enzymes and Fxr-mediated signaling pathways in the liver and ileum exhibit significant circadian rhythms in mice with gallbladder. Following by cholecystectomy, the circadian oscillations of most of the elements mentioned above are flattened and altered, and this could mainly be

CHRONOBIOLOGY INTERNATIONAL

ascribed to the disappearance of the filling and emptying cycle of the gallbladder. Even more importantly, the circadian desynchronization after cholecystectomy might result in drug chronopharmacology alternation, metabolic diseases like dyslipidemia or exacerbate pathological states. Nevertheless, there is also the question of whether these findings could be translated to the human situation whose BA pool has differences with mice under most physiological conditions, and it needs to be further studied. At least, we expect that this study would be of great value to provide a cue for patients with cholecystectomy. Acknowledgments The authors are especially grateful to the center laboratory and the pathology department of the first Hospital of Lanzhou University for assistance in the experiments.

Declaration of interest The authors who have taken part in this study declared that they do not have anything to disclose regarding funding or conflict of interest with respect to this manuscript.

Funding Prof. Xinan Wu and Dr. Yuhui Wei were supported by the National Natural Science Foundation of China (Numbers: 81373494 and 81373927).

References Amigo L, Husche C, Zanlungo S, Lutjohann D, Arrese M, Miquel JF, Rigotti A, Nervi F. 2011. Cholecystectomy increases hepatic triglyceride content and very-low-density lipoproteins production in mice. Liver Int off J Int Assoc Study Liver 31:52–64. doi:10.1111/j.14783231.2010.02361.x. Brown AJ, Sharpe LJ. 2016. Bile acid metabolism. In McLeod NDRS, editor. Biochemistry of lipids, lipoproteins and membranes, 6th Edn. Boston: Elsevier. p. 359–89. Chen J, Zhao KN, Chen C. 2014. The role of CYP3A4 in the biotransformation of bile acids and therapeutic implication for cholestasis. Ann Trans Med 2:7. doi:10.3978/j. issn.2305-5839.2013.03.02. de Aguiar Vallim TQ, Tarling EJ, Edwards PA. 2013. Pleiotropic roles of bile acids in metabolism. Cell Metab 17:657–69. doi:10.1016/j.cmet.2013.03.013. Eggink HM, Oosterman JE, de Goede P, de Vries EM, Foppen E, Koehorst M, Groen AK, Boelen A, Romijn JA, la Fleur SE, et al. 2017. Complex interaction between circadian rhythm

17

and diet on bile acid homeostasis in male rats. Chronobiol Int 1–15. doi:10.1080/07420528.2017.1363226. Froy O. 2009. Cytochrome P450 and the biological clock in mammals. Curr Drug Metab 10:104–15. Gachon F, Firsov D. 2011. The role of circadian timing system on drug metabolism and detoxification. Expert Opin Drug Metab Toxicol 7:147–58. doi:10.1517/ 17425255.2011.544251. Govindarajan K, MacSharry J, Casey PG, Shanahan F, Joyce SA, Gahan CG. 2016. Unconjugated bile acids influence expression of circadian genes: a potential mechanism for microbe-host crosstalk. PloS One 11:e0167319. doi:10.1371/journal.pone.0167319. Halilbasic E, Claudel T, Trauner M. 2013. Bile acid transporters and regulatory nuclear receptors in the liver and beyond. J Hepatol 58:155–68. doi:10.1016/j.jhep.2012.08.002. Housset C, Chretien Y, Debray D, Chignard N. 2016. Functions of the gallbladder. Compr Physiol 6:1549–77. doi:10.1002/cphy.c150050. Jonker JW, Liddle C, Downes M. 2012. FXR and PXR: Potential therapeutic targets in cholestasis. J Steroid Biochem Mol Biol 130:147–58. doi:10.1016/j.jsbmb.2011.06.012. Kim I, Ahn SH, Inagaki T, Choi M, Ito S, Guo GL, Kliewer SA, Gonzalez FJ. 2007. Differential regulation of bile acid homeostasis by the farnesoid X receptor in liver and intestine. J Lipid Res 48:2664–72. doi:10.1194/jlr.M700330-JLR200. Kuipers F, Bloks VW, Groen AK. 2014. Beyond intestinal soap-bile acids in metabolic control. Nat Rev Endocrinol 10:488–98. doi:10.1038/nrendo.2014.60. Lefebvre P, Cariou B, Lien F, Kuipers F, Staels B. 2009. Role of bile acids and bile acid receptors in metabolic regulation. Physiol Rev 89:147–91. doi:10.1152/physrev.00010.2008. Li T, Chiang JY. 2013. Nuclear receptors in bile acid metabolism. Drug Metab Rev 45:145–55. doi:10.3109/ 03602532.2012.740048. Li T, Chiang JY. 2014. Bile acid signaling in metabolic disease and drug therapy. Pharmacol Rev 66:948–83. doi:10.1124/ pr.113.008201. Li T, Francl JM, Boehme S, Ochoa A, Zhang Y, Klaassen CD, Erickson SK, Chiang JY. 2012. Glucose and insulin induction of bile acid synthesis: Mechanisms and implication in diabetes and obesity. J Biol Chem 287:1861–73. doi:10.1074/jbc.M111.305789. Lu YF, Jin T, Xu Y, Zhang D, Wu Q, Zhang YK, Liu J. 2013. Sex differences in the circadian variation of cytochrome p450 genes and corresponding nuclear receptors in mouse liver. Chronobiol Int 30:1135–43. doi:10.3109/ 07420528.2013.805762. Ma K, Xiao R, Tseng HT, Shan L, Fu L, Moore DD. 2009. Circadian dysregulation disrupts bile acid homeostasis. PloS One 4:e6843. doi:10.1371/journal.pone.0006843. Nervi F, Arrese M. 2013. Cholecystectomy and NAFLD: Does gallbladder removal have metabolic consequences? Am J Gastroenterol 108:959–961. doi:10.1038/ajg.2013.84. Reinke H, Asher G. 2016. Circadian clock control of liver metabolic functions. Gastroenterology 150:574–80. doi:10.1053/j.gastro.2015.11.043.

18

F. ZHANG ET AL.

Ridlon JM, Wolf PG, Gaskins HR. 2016. Taurocholic acid metabolism by gut microbes and colon cancer. Gut Microbes 1–15. doi:10.1080/19490976.2016.1150414. Ruhl CE, Everhart JE. 2013. Relationship of non-alcoholic fatty liver disease with cholecystectomy in the US population. Am J Gastroenterol 108:952–58. doi:10.1038/ajg.2013.70. Sayin SI, Wahlstrom A, Felin J, Jantti S, Marschall HU, Bamberg K, Angelin B, Hyotylainen T, Oresic M, Backhed F. 2013. Gut microbiota regulates bile acid metabolism by reducing the levels of tauro-beta-muricholic acid, a naturally occurring FXR antagonist. Cell Metab 17:225–35. doi:10.1016/j.cmet.2013.01.003. Siddiqui AA, Kedika R, Mahgoub A, Patel M, Cipher DJ, Bapat V. 2009. A previous cholecystectomy increases the risk of developing advanced adenomas of the colon. South Med J 102:1111–15. doi:10.1097/SMJ.0b013e3181b85063. Thakkar N, Slizgi JR, Brouwer KLR. 2017. Effect of liver disease on hepatic transporter expression and function. J Pharm Sci doi:10.1016/j.xphs.2017.04.053. Trauner M, Claudel T, Fickert P, Moustafa T, Wagner M. 2010. Bile acids as regulators of hepatic lipid and

glucose metabolism. Dig Dis 28:220–24. doi:10.1159/ 000282091. Werk AN, Cascorbi I. 2014. Functional gene variants of CYP3A4. Clin Pharmacol Ther 96:340–48. doi:10.1038/clpt.2014.129. Zhang F, Qin H, Zhao Y, Wei Y, Xi L, Rao Z, Zhang J, Ma Y, Duan Y, Wu X. 2017. Effect of cholecystectomy on bile acids as well as relevant enzymes and transporters in mice: Implication for pharmacokinetic changes of rifampicin. Eur J Pharm Sci 96:141–53. doi:10.1016/j. ejps.2016.09.006. Zhang YK, Guo GL, Klaassen CD. 2011. Diurnal variations of mouse plasma and hepatic bile acid concentrations as well as expression of biosynthetic enzymes and transporters. PloS One 6:e16683. doi:10.1371/journal.pone.0016683. Zhou H, Hylemon PB. 2014. Bile acids are nutrient signaling hormones. Steroids 86:62–68. doi:10.1016/j. steroids.2014.04.016. Zhu Y, Li F, Guo GL. 2011. Tissue-specific function of farnesoid X receptor in liver and intestine. Pharmacol Res off J Italian Pharmacol Soc 63:259–65. doi:10.1016/j. phrs.2010.12.018.